dCas9-KRAB Lentivirus
Cat. No. | K204 |
Name | dCas9-KRAB Lentivirus |
Unit | 4 x 500ul |
Description |
dCas9-KRAB is used for CRISPR gene repression (CRISPRi). The Cas9 Double Mutant (dCas9) has changes at amino acid positions D10A and H840A which completely inactivate both the nuclease and nickase activities. In this construct, dCas9 carries a C-terminal Krüppel associated box (KRAB) domain. By targeting dCas9-KRAB to a promoter region, users will be able to specifically repress expression of virtually any gene of interest. This dCas9-KRAB lentivirus can be transduced for high efficiency stable integration of dCas9-KRAB into host cells. Use this dCas9-KRAB lentivirus in conjunction with a CRISPRi sgRNA lentivirus designed specifically for CRISPR repression. |
Vector | pLenti-EF1a-dCas9-KRAB |
Titer | 107 IU/mL |
Print & Download Datasheet
Search CoA here
There are no Documents for this product yet!
How long after transduction can the infection efficiency be observed? | |
You can observe transduction efficiency from 48 hours up to 5 days after infection.
|
What are the primers to use for SV40T and SV40T tsA58 detection? | |
PCR primers:
SV40T Forward Primer Sequence
5’ AGCCTGTAGAACCAAACATT 3'
SV40T Reverse Primer Sequence
5’ CTGCTGACTCTCAACATTCT 3'
The two primers should amplify the region between 3677-4468bp, giving a 792bp fragment.
|
What is the sequence of the SV40 large T antigen? | |
This information can be accessed on this page by clicking on "pLenti-SV40-T" under vector map. The Large T antigen is at position 5079-5927.
|
For G221 and LV620, what does the 'V12' in RasV12 mean? | |
The V12 means that amino acid # 12 is mutated from a Valine to a Glycine. Other than that, the sequence matches the coding region of HRAS perfectly (NM_005343).
|
Where is the SV40T tsA58 gene sequence? | |
The SV40T tsA58 gene is located between 3138-5264bp, with the Alanine-to-Valine mutation at amino acid 438.
|
There are no references for this product yet!
This product has no review yet.