ZNF266 AAV siRNA Pooled Vector

The lentivirus should be aliquoted into smaller working volumes and then stored at -80°C. Lentivirus is sensitive to storage temperature and to freeze/thaws. It can lose up to 5% or more activity with each freeze/thaw. When stored properly, viral stocks of an appropriate titer should be suitable for use for up to one year. After long-term storage, we recommend re-titering your viral stocks before use.

abm’s lentiviral transfer vectors use the third generation lentivirus system. It is based on the inactivated HIV genome. Note that our lentivirus packaging plasmids cannot be integrated into the host and are transiently expressed.

Retrovirus: Classic, can integrate into the genome but with low transduction efficiency. They are useful for gene transfer and protein expression in cells that have low transfection efficiency with other transfection reagents. Lentivirus: Can integrate into the genome with relatively high transduction efficiency and they are very useful for cells that have low transfection efficiency with other transfection reagents. No special competent cells required, as they are stable plasmids. Lentiviruses are a powerful tool for stable gene transfer to both dividing and non-dividing cells in vitro and in vivo. Adenovirus: Only work transiently (about 7 days) but have almost 100% transduction efficiency. Adenoviruses can infect a broad range of cell types with the highest efficiency and infection is not dependent on active host cell division. A second key feature is that high virus titers and high-level gene expression can be obtained in most mammalian cells.

For lentiviruses and retroviruses, they are measured in CFU/ml (colony-forming units per millilitre). Transduction with lentiviruses and retroviruses can cause the formation of colonies, which can be quantified for concentration. For AAV the titer is measured as genome copies per mL (GC/mL). Adenoviruses are measured as PFU/ml (plaque-forming units per millilitre). Transduction with adenoviruses will kill packaging cells, forming plaques in the process for quantification. The concentration for all three types of viruses can also be classified as IU/ml (Infectious Units/ml). Ultimately, the units refers to the viral particles and different units reflect the different assays involved.

We have an SV40 T antibody that can be used for the western blot analysis. The catalog number is G202. Otherwise, a qPCR primer can be designed on the SV40 gene for qPCR analysis. The sequence can be found in the link below: http://www.abmgood.com/pLenti%20SV40-Vector-Location-Map.html

SV40 Forward Primer Sequence 5’ ACTGAGGGGCCTGAAATGA SV40 Reverse Primer Sequence 5’ GACTCAGGGCATGAAACAGG These are qPCR primers and the band size is 61 bp.

HpaI or PacI will work to linearize the vector. Both sites are located outside of the LTRs.

Our scramble negative control can be used for human, mouse and rat. Please refer to Cat.# LV015-G for ordering information.

Yes, our siRNA lentivectors are 3rd generation, but can be packaged using either 2nd or 3rd generation packaging systems.

You can use Lipofectamine to transiently transfect the vectors to your target cells. Since the effect of an siRNA on a gene in a particular cell line can vary, we suggest choosing the set of 4 siRNA constructs to increase your chances of getting good knockdown of your target gene in your cells.

Our RNA interference lentiviral vectors contain siRNAs. We employ a dual convergent promoter system where the sense and antisense strands of the siRNA are expressed by two different promoters rather than in a hairpin loop - to avoid any possible recombination events that can occur. In cases where there are no verified and published siRNA sequences for your gene of interest, we use our siRNA design software to locate suitable target sites. If these designed siRNAs don't give efficient knock down of gene expression in your experiments, we offer a onetime replacement (free of charge) that will contain a new set of sequences to try. ABM guarantees that at least one out of the four siRNA Lentivector constructs purchased in a set will give over 70% knockdown efficiency within appropriate target cells showing >80% transfection efficiency. If these four constructs are still considered to be ineffective, then it is most likely the gene is not susceptible to siRNA knockdown.

The Phoenix 293T cells are suitable for retrovirus packaging but not for lentivirus packaging. To package our lentivectors, you will need to use a 2nd or 3rd generation packaging mix, like the ones we have here: http://www.abmgood.com/Lentivirus-Packaging-Systems.html

Since every gene is different, it is best to optimize the transfection condition to allow for the most siRNA vector used without having toxicity. Try transfecting a series of 5ug, 8ug, 10ug and 12ug of the siRNA with your cells and the best one will be the highest siRNA used without seeing toxicity.

These are high copy plasmids and should be propagated with an authentic DH5a strain. We typically see a yield of 300-500ug DNA from a 250mL culture.

There are simply differences in the content of all vectors due to customer demand for variety. Lenti-SV40 will contain the whole SV40 gene, -SV40T, the large T Antigen only, and -SV40T&t the large and small T antigens only. It is up to the end user to decide which vectors will best suit their project, however we have successfully used Lenti-SV40 (whole gene) in a wide range of immortalization projects.

One forward sequencing reaction using the U6 primer should be sufficient: U6 forward sequencing primer 5'-TACGTCCAAGGTCGGGCAGGAAGA-3'

BamHI will cut out GFP in these vectors, so you should see a 0.8kb band when you cut the plasmids with this enzyme (applies only to vectors containing GFP). Another method you can use to check for the insert is to perform an EcoRI digest. The parental vector contains 2 EcoRI sites, one between the two BbsI sites which were used to clone in the insert, and one located immediately after GFP. If the insert is cloned in, the first EcoRI site will be removed, and when this is cut by EcoRI, you will only get a linearized vector band. Ones that are still the parental plasmid with no insert cloned in will still contain both EcoRI sites, and cutting with EcoRI will give 2 bands, ~8.2kb + 0.8kb. Alternatively KpnI should give a 0.9kb band if the insert is present, and a linear vector band only if there is no insert present. The siRNA insert is cloned in with a KpnI site for screening purposes.

We recommend transfecting 2ug DNA (0.5ug/ul) per well of a 6-well plate.

The vector sets are supplied as 4 individual constructs, only the pooled lentivirus is supplied as a mixed solution. Please also note that our system utilizes the expression of mature siRNA sequences from two convergent promoters and this is not a hairpin loop, shRNA based system.

The SV40 covers the entire genome and the accession number is J02400.1. You can use this information to design primers for conventional PCR as well.

1) Cut out the circle on the filter paper (this is where the DNA will be spotted), and then cut it into tiny pieces into a 1.5ml tube. 2) Put 30-50ul of PCR-grade water, 10mM Tris, or TE buffer to elute the DNA from the filter paper. The liquid may be completely soaked up by the filter, this is OK. Cap the tube and leave at room temperature for 5 minutes. 3) Centrifuge the tube at high speed for 1 minute to collect the liquid, or use a pipette and "compress" the filter paper at the bottom of the tube to squeeze out as much liquid as possible. Collect the liquid in a new tube, and then use DH5a competent cells to amplify the plasmid, use the suitable antibiotic to select for positive clones.

You can observe transduction efficiency from 48 hours up to 5 days after infection.

PCR primers: SV40T Forward Primer Sequence 5’ AGCCTGTAGAACCAAACATT 3' SV40T Reverse Primer Sequence 5’ CTGCTGACTCTCAACATTCT 3' The two primers should amplify the region between 3677-4468bp, giving a 792bp fragment.

This information can be accessed on this page by clicking on "pLenti-SV40-T" under vector map. The Large T antigen is at position 5079-5927.

We would recommend packaging separately first, so that you can see which construct works better prior to pooling them together to infect your target cells.

This is not the wildtype 5'LTR. The U3 region is removed.

siRNA and shRNA have the same intention and they are to silent gene expression by cleaving the target mRNA. However, their differences are as follows: a) siRNA (small interfering RNA) is a linear sequence that binds to the target mRNA and cleaves it, preventing the unwanted protein from being made b) shRNA (short hairpin RNA) is a DNA construct encoding a sequence of single stranded RNA and its complement, separated by a stuffer fragment, allowing the RNA molecule to fold back on itself, creating a hairpin loop Traditionally, siRNA is made synthetically and introduced into the cells as is which is short lived; whereas shRNA is cloned into a vector and then introduced cell's genome, which can prolong expression. However, shRNA poses a difficulty on amplification and sequencing and thus it is not easy to construct. abm has come up with a novel technology where we combined the ability to clone siRNA into a vector, but with the same effect as shRNA. With the help of a dual convergent promoter vector system, the sense and antisense strands of the siRNA are expressed by two different promoters rather than in a hairpin loop, which thus avoids any possible recombination events that can occur. However, the siRNA sequence is expressed in both directions, and therefore mimicks the actions of shRNA.

The V12 means that amino acid # 12 is mutated from a Valine to a Glycine. Other than that, the sequence matches the coding region of HRAS perfectly (NM_005343).

The SV40T tsA58 gene is located between 3138-5264bp, with the Alanine-to-Valine mutation at amino acid 438.

We recommend storing abm’s vectors at -20°C and avoiding repeated freeze/thaws as this may affect plasmid integrity and cloning efficiency.