CRISPR Scrambled sgRNA CRISPR Lentiviral Vector (for spCas9)
Cat. No.
K018
Unit
1.0 µg
Price
$144.00
| Cat. No. | K018 |
| Name | CRISPR Scrambled sgRNA CRISPR Lentiviral Vector (for spCas9) |
| Category | Control Vectors & Viruses |
| Description |
Control CRISPR Lentiviral Vector with scrambled sgRNA for spCas9. scrambled sequence：GCACTCACATCGCTACATCA |
| Vector Map | pLenti-U6-sgRNA-PGK-Neo (click blue link to view) |
| Caution | This product is for research use only and is not intended for therapeutic or diagnostic applications. Please contact a technical service representative for more information. |
| Material Citation | If use of this material results in a scientific publication, please cite the material in the following manner: Applied Biological Materials Inc, Cat. No. K018 |
Print & Download Datasheet
| How should I store my lentivirus? | |
|
The lentivirus should be aliquoted into smaller working volumes and then stored at -80°C. Lentivirus is sensitive to storage temperature and to freeze/thaws. It can lose up to 5% or more activity with each freeze/thaw. When stored properly, viral stocks of an appropriate titer should be suitable for use for up to one year. After long-term storage, we recommend re-titering your viral stocks before use.
|
| What generation does abm use for their lentiviral transfer vectors? | |
|
abm’s lentiviral transfer vectors use the third generation lentivirus system. It is based on the inactivated HIV genome. Note that our lentivirus packaging plasmids cannot be integrated into the host and are transiently expressed.
|
| What is the difference between Retro-, Lenti-, and Adeno- viruses? | |
|
Retrovirus: Classic, can integrate into the genome but with low transduction efficiency. They are useful for gene transfer and protein expression in cells that have low transfection efficiency with other transfection reagents. Lentivirus: Can integrate into the genome with relatively high transduction efficiency and they are very useful for cells that have low transfection efficiency with other transfection reagents. No special competent cells required, as they are stable plasmids. Lentiviruses are a powerful tool for stable gene transfer to both dividing and non-dividing cells in vitro and in vivo. Adenovirus: Only work transiently (about 7 days) but have almost 100% transduction efficiency. Adenoviruses can infect a broad range of cell types with the highest efficiency and infection is not dependent on active host cell division. A second key feature is that high virus titers and high-level gene expression can be obtained in most mammalian cells.
|
| What are the correct concentration units for each recombinant viral particle? | |
|
For lentiviruses and retroviruses, they are measured in CFU/ml (colony-forming units per millilitre). Transduction with lentiviruses and retroviruses can cause the formation of colonies, which can be quantified for concentration. For AAV the titer is measured as genome copies per mL (GC/mL). Adenoviruses are measured as PFU/ml (plaque-forming units per millilitre). Transduction with adenoviruses will kill packaging cells, forming plaques in the process for quantification. The concentration for all three types of viruses can also be classified as IU/ml (Infectious Units/ml). Ultimately, the units refers to the viral particles and different units reflect the different assays involved.
|
| What do I use to check if my cells were successfully immortalized by the SV40 agent? | |
|
We have an SV40 T antibody that can be used for the western blot analysis. The catalog number is G202.
Otherwise, a qPCR primer can be designed on the SV40 gene for qPCR analysis. The sequence can be found in the link below:
http://www.abmgood.com/pLenti%20SV40-Vector-Location-Map.html
|
| What are the primers to use for SV40 identification? | |
|
SV40 Forward Primer Sequence
5’ ACTGAGGGGCCTGAAATGA
SV40 Reverse Primer Sequence
5’ GACTCAGGGCATGAAACAGG
These are qPCR primers and the band size is 61 bp.
|
| What advantages / disadvantages exist between the Lenti-SV40, -SV40T, and SV40T+t vectors? | |
|
There are simply differences in the content of all vectors due to customer demand for variety. Lenti-SV40 will contain the whole SV40 gene, -SV40T, the large T Antigen only, and -SV40T&t the large and small T antigens only.
It is up to the end user to decide which vectors will best suit their project, however we have successfully used Lenti-SV40 (whole gene) in a wide range of immortalization projects.
|
| What is the accession number for the SV40? | |
|
The SV40 covers the entire genome and the accession number is J02400.1. You can use this information to design primers for conventional PCR as well.
|
| How long after transduction can the infection efficiency be observed? | |
|
You can observe transduction efficiency from 48 hours up to 5 days after infection.
|
| What are the primers to use for SV40T and SV40T tsA58 detection? | |
|
PCR primers:
SV40T Forward Primer Sequence
5’ AGCCTGTAGAACCAAACATT 3'
SV40T Reverse Primer Sequence
5’ CTGCTGACTCTCAACATTCT 3'
The two primers should amplify the region between 3677-4468bp, giving a 792bp fragment.
|
| What is the sequence of the SV40 large T antigen? | |
|
This information can be accessed on this page by clicking on "pLenti-SV40-T" under vector map. The Large T antigen is at position 5079-5927.
|
| For G221 and LV620, what does the 'V12' in RasV12 mean? | |
|
The V12 means that amino acid # 12 is mutated from a Valine to a Glycine. Other than that, the sequence matches the coding region of HRAS perfectly (NM_005343).
|
| Where is the SV40T tsA58 gene sequence? | |
|
The SV40T tsA58 gene is located between 3138-5264bp, with the Alanine-to-Valine mutation at amino acid 438.
|
| How should I store abm’s vectors? | |
|
We recommend storing abm’s vectors at -20°C and avoiding repeated freeze/thaws as this may affect plasmid integrity and cloning efficiency.
|
- Yang, H., Deng, M., Lv, W., Wei, Z., Cai, Y., Cheng, P., Wang, F., & Zhang, Y. (2022). Overexpression of bmp4, dazl, nanos3 and sycp2 in Hu Sheep Leydig Cells Using CRISPR/dcas9 System Promoted Male Germ Cell Related Gene Expression. Biology, 11(2), 289. https://doi.org/10.3390/biology11020289
-
Srinath S, Jishnu PV, Varghese VK, Shukla V, Adiga D, Mallya S, Chakrabarty S, Sharan K, Pandey D, Chatterjee A, Kabekkodu SP. Regulation and tumor-suppressive function of the miR-379/miR-656 (C14MC) cluster in cervical cancer. Mol Oncol. 2024 Feb 23. doi: 10.1002/1878-0261.13611. Epub ahead of print. PMID: 38400534.
This product has no review yet.
Other Products
E. coli
Human
Human (H. sapiens)
Luc
Luciola italica
N/A
Other
Photinus pyralis
Renilla reniformis
Serotype 1
Serotype 10
Serotype 2
Serotype 3
Serotype 4
Serotype 5
Serotype 6
Serotype 7
Serotype 8
Serotype 9
Lentiviral
Vector
AAV
Vector
Adenovirus
Vector
Protein
Vector
ORF
Vector
siRNA
Vector
miRNA
Vector
3'UTR
Vector
CRISPR Knockout
Vector
CRISPR Activation
Vector
Control Vectors & Viruses
Vector
circRNA
Vector
Internal
Vector