CRISPR Scrambled sgRNA Lentivirus (for spCas9)

Cat. No.
K019
Unit
4 x 500ul
Price
$212.00
Cat. No. K019
Name CRISPR Scrambled sgRNA Lentivirus (for spCas9)
Unit 4 x 500ul
Category Control Vectors & Viruses
Description

Control CRISPR Lentivirus with scrambled sgRNA for spCas9.

scrambled sequence:GCACTCACATCGCTACATCA

Vector Map pLenti-U6-sgRNA-PGK-Neo (click blue link to view)
Titer 107 IU/mL
Caution This product is for research use only and is not intended for therapeutic or diagnostic applications. Please contact a technical service representative for more information.
Material Citation If use of this material results in a scientific publication, please cite the material in the following manner: Applied Biological Materials Inc, Cat. No. K019
Print & Download Datasheet
  • Dai, X., Chen, X., Hakizimana, O., & Mei, Y. "Genetic interactions between ANLN and KDR are prognostic for breast cancer survival" Oncology Reports. : (2019).
This product has no review yet.
Other Products
E. coli
Human
Human (H. sapiens)
Luc
Luciola italica
N/A
Other
Photinus pyralis
Renilla reniformis
Serotype 1
Serotype 10
Serotype 2
Serotype 3
Serotype 4
Serotype 5
Serotype 6
Serotype 7
Serotype 8
Serotype 9

Lentiviral Vector
AAV Vector
Adenovirus Vector
Protein Vector
ORF Vector
siRNA Vector
miRNA Vector
3'UTR Vector
CRISPR Knockout Vector
CRISPR Activation Vector
Control Vectors & Viruses Vector
circRNA Vector
Internal Vector