CRISPRa dCas9-VPR Lentivirus
Cat. No. | K098 |
Name | CRISPRa dCas9-VPR Lentivirus |
Unit | 4 x 500µl |
Description |
This Cas9 Double Mutant (dCas9) carries the mutations D10A and H840A which inactivates both nuclease and nickase activities. Using a target-specific guide RNA (sgRNA), it can bind to a specific genomic position without inducing DNA cleavage. In this construct, dCas9 is fused to the tripartite complex VPR (VP64, p65 and Rta). These transcriptional activators work in tandem to recruit transcription factors which in turn up-regulate expression of your gene of interest. In comparison to dCas9-SAM system, dCas9-VPR does not require specialized MS2 sgRNAs and it allows for streamlined transfection or infection as the vector encodes a single fusion protein. |
Vector | pLenti-SFFV-dCas9-VPR |
Titer | 107 IU/ml |
Material Citation | If use of this material results in a scientific publication, please cite the material in the following manner: Applied Biological Materials Inc, Cat. No. K098 |
Print & Download Datasheet
Search CoA here
Other
How long after transduction can the infection efficiency be observed? | |
You can observe transduction efficiency from 48 hours up to 5 days after infection.
|
What are the primers to use for SV40T and SV40T tsA58 detection? | |
PCR primers:
SV40T Forward Primer Sequence
5’ AGCCTGTAGAACCAAACATT 3'
SV40T Reverse Primer Sequence
5’ CTGCTGACTCTCAACATTCT 3'
The two primers should amplify the region between 3677-4468bp, giving a 792bp fragment.
|
What is the sequence of the SV40 large T antigen? | |
This information can be accessed on this page by clicking on "pLenti-SV40-T" under vector map. The Large T antigen is at position 5079-5927.
|
For G221 and LV620, what does the 'V12' in RasV12 mean? | |
The V12 means that amino acid # 12 is mutated from a Valine to a Glycine. Other than that, the sequence matches the coding region of HRAS perfectly (NM_005343).
|
Where is the SV40T tsA58 gene sequence? | |
The SV40T tsA58 gene is located between 3138-5264bp, with the Alanine-to-Valine mutation at amino acid 438.
|
- Bayati, A et al. (2022). "Rapid macropinocytic transfer of α-synuclein to lysosomes." Cell Reports. 40(3):111102. DOI: 10.1016/j.celrep.2022.111102. Application: Organelle Labeling Lentivirus.
This product has no review yet.